Mycoplasma hyorhinis

(Switzer, 1955)

Etymology

Gr. n. mukes – fungus, Gr. neut. n. plasma – anything formed, N.L. neut. n. Mycoplasma – fungus form; Gr. n. hus – a swine, Gr. n. rhis – nose, N.L. gen. n. hyorhinis – of the nose of a swine

Taxonomy

Mycoplasmatales – Mycoplasmataceae – Mycoplasma – Mycoplasma hyorhinis (Hyopneumoniae cluster), separated branch, related to Mycoplasma conjunctivae (16S rRNA gene sequence similarity – 93.37%) (Fig. 1)

Type strain

BTS-7^T (swine, USA, ≤1955) (Fig. 2, 16S rRNA gene sequence)

Genomes

10 completed (2x PG42^T – USA; HUB-1 – China; SK76 – USA; 2 x GDL-1 cell culture isolate– origin undefined; MCLD cell culture isolate – Israel; DBS 1050 cultivar α cell culture isolate – origin undefined; MDBK-IBV cell culture isolate – Brazil; JF5820 - Switzerland; 4236J19c, 4453J21c, 4455N20c, N36N21c – Austria; Nahrain cell culture isolate – Iraq); 85 draft genomes (NCBI Genome deposit per 11/05/2024)

Cell morphology

spherical – coccoid

Colony morphology

fried egg morphology, variable in size and in opacity (Fig. 3)

Metabolism

fermentation of glucose; assimilation of glycerol; non-arginine-hydrolyzing, non-urea-hydrolyzing

Host

swine

Habitat

upper respiratory tract

Disease(s)

polyserositis and arthritis in postweaning pigs under ten weeks of age, probably involved in PRDC and MIRD, occasionally reported to cause conjunctivitis, otitis and meningoencephalitis

Pathogenicity

factors largely unknown, known factors include a family of phase- and size-variable membrane surface lipoproteins (Vlp’s) with roles in adhesion and immune evasion, cell invasion, hydrogen peroxide production via glycerol assimilation, methylation of host cell DNA (via DNA-methyltransferases)

Epidemiology

worldwide occurrence in swine, common contaminant of cell cultures; transmission via sow-piglet contact, rapid spread in postweaning pigs

Diagnosis

cultivation and species identification by MALDI-ToF MS, serology or genetically; PCR

Fig. 1. Maximum likelihood tree showing the phylogenetic position of Mycoplasma hyorhinis BTS7^T within the Hyopneumoniae cluster of Mycoplasmataceae based on 16S rRNA gene sequences. The sequence of Mycoplasma synoviae WVU 1853^T was used as out-group (Synoviae cluster). Numbers at nodes represent bootstrap confidence values (1000 replications). Only values > 80% are shown. Bar, number of substitutions per nucleotide position. Credits: Joachim Spergser (Vetmeduni Vienna)

>Mycoplasma hyorhinis BTS-7^T

CTCGCTGTGTGCCTAATACATGCATGTTGAACGGGATGTAGCAATACATTCAGTAGCGAATGGGTGAGTAACACGTACCTAACCTACCTTTAAGACTGGGATAACTATTGGAAACAATAGCTAATACCGGATATAGTTATTTATCGCATGATGAGTAATAGAAAGGAGCTTCACAGCTTCACTTAAAAATGGGGGTGCGGAACATTAGTTAGTTGGTAGGGTAATGGCCTACCAAGACGATGATGTTTAGCCGGGCCGAGAGGCTGTACGGCCACACTGGGACTGAGATACGGCCCAGACTCCTACGGGAGGCAGCAGTAAGGAATTTTCCACAATGAGCGAAAGCTTGATGGAGCGACACAGCGTGCAGGATGAAGTTCTTCGGAATGTAAACTGCTGTTATAAGGGAAGAAAAAATAGAATAGGAAATGATTTTATCTTGACGGTACCTTATTAGAAAGCGACGGCAAACTATGTGCCAGCAGCCGCGGTAATACATAGGTCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTCCGTAGGTTTTTTGCTAAGTCTGGAGTTAAATGCTGAAGCTCAACTTCAGTCCGCTTTGGATACTGGCAAAATAGAATTATAAAGAGGTTAGCGGAATTCCTAGTGAAGCGGTGGAATGCGTAGATATTAGGAAGAACACCAATAGGCGAAGGCAGCTAACTGGTTATATATTGACACTAAGGGACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATCATTAGTTGGTGGAATAATTTCACTAACGCAGCTAACGCGTTAAATGATCCGCCTGAGTAGTATGCTCGCAAGAGTGAAACTTAAAGGAATTGACGGGAACCCGCACAAGCGGTGGAGCATGTGGTTTAATTTGAAGATACGCGTAGAACCTTACCCACTCTTGACATCTTCTGCAAAGCTATAGAGATATAGTGGAGGTTAACAGAATGACAGATGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTAGGTTAAGTCCTGCAACGAGCGCAACCCTTTTCTTTAGTTACTAATATTAAGTTAAGGACTCTAGAGATACTGCCTGGGTAACCAGGAGGAAGGTGGGGACGACGTCAAATCATCATGCCTCTTACGAGTGGGGCAACACACGTGCTACAATGGTCGGTACAAAGAGAAGCAATATGGTGACATGGAGCAAATCTCAAAAAACCGATCTCAGTTCGGATTGAAGTCTGCAACTCGACTTCATGAAGTCGGAATCGCTAGTAATCGTAGATCAGCTACGCTACGGTGAATACGTTCTCGGGTTTTGTACACACCGCCCGTCACACCATGGGAGTTGGTAATGCCCAAAGTCGGTGAGTTAACTTCGGAGACCATTGCCTAAGGCAGGACTGATGACTGGGGTGAAGTCGTAACAAGGT

Fig. 2. 16S rRNA gene sequence of Mycoplasma hyorhinis BTS-7^T(Accession number: NR_041845)

Fig. 3. Colonies of Mycoplasma hyorhinis BTS-7^T on modified Hayflick’s agar after 5 days of incubation exhibiting fried egg morphology and variability in size and in opacity. Bar, 1 mm. Credits: Joachim Spergser (Vetmeduni Vienna)

Species assigned by: Switzer, W.P. 1955. Studies on infectious atrophic rhinitis. IV. Characterization of a pleuropneumonia-like organism isolated from the nasal cavities of swine. Am. J. Vet. Res. 16: 540-544.